Gravicode.Biotech.Net.DrugDiscovery 0.2.0

Prefix Reserved

dotnet add package Gravicode.Biotech.Net.DrugDiscovery --version 0.2.0

NuGet\Install-Package Gravicode.Biotech.Net.DrugDiscovery -Version 0.2.0

This command is intended to be used within the Package Manager Console in Visual Studio, as it uses the NuGet module's version of Install-Package.

<PackageReference Include="Gravicode.Biotech.Net.DrugDiscovery" Version="0.2.0" />

For projects that support PackageReference, copy this XML node into the project file to reference the package.

<PackageVersion Include="Gravicode.Biotech.Net.DrugDiscovery" Version="0.2.0" />
                    

                            Directory.Packages.props

<PackageReference Include="Gravicode.Biotech.Net.DrugDiscovery" />
                    

                            Project file

For projects that support Central Package Management (CPM), copy this XML node into the solution Directory.Packages.props file to version the package.

paket add Gravicode.Biotech.Net.DrugDiscovery --version 0.2.0

The NuGet Team does not provide support for this client. Please contact its maintainers for support.

#r "nuget: Gravicode.Biotech.Net.DrugDiscovery, 0.2.0"

#r directive can be used in F# Interactive and Polyglot Notebooks. Copy this into the interactive tool or source code of the script to reference the package.

#:package Gravicode.Biotech.Net.DrugDiscovery@0.2.0

#:package directive can be used in C# file-based apps starting in .NET 10 preview 4. Copy this into a .cs file before any lines of code to reference the package.

#addin nuget:?package=Gravicode.Biotech.Net.DrugDiscovery&version=0.2.0
                    

                            Install as a Cake Addin

#tool nuget:?package=Gravicode.Biotech.Net.DrugDiscovery&version=0.2.0
                    

                            Install as a Cake Tool

The NuGet Team does not provide support for this client. Please contact its maintainers for support.

Biotech.Net

Ultimate Biotechnology & Bioinformatics Platform for .NET — the Bioconductor + Biopython of .NET 10, with Rust-accelerated kernels.

Dibuat oleh Gravicode Studios dipimpin oleh Kang Fadhil

English

Biotech.Net is an open-source platform for biotechnology, bioinformatics, computational biology, genomics, proteomics, drug discovery, synthetic biology and biotech AI, built for .NET 10. Hot paths run on Rust kernels through a C ABI; every kernel also has a managed C# implementation, so the library works even without the native binary.

Quick start

dotnet add package Gravicode.Biotech.Net.Core
dotnet add package Gravicode.Biotech.Net.Sequences

using Biotech.Net.Core;
using Biotech.Net.Sequences;

var dna = Sequence.Dna("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG", "demo");
Console.WriteLine($"{dna.Length} bp, GC {dna.GcContent():P1}");
Console.WriteLine(dna.ReverseComplement());
Console.WriteLine(dna.Translate(toStop: true));              // MAIVMGR
Console.WriteLine($"{OrfFinder.Find(dna, new OrfOptions { MinLength = 30 }).Count} ORFs");

Modules

Package	What it does
`Gravicode.Biotech.Net.Native`	Rust kernels (sequence, alignment, statistics, protein, structure) with a managed fallback
`Gravicode.Biotech.Net.Core`	`Sequence`, `Alphabet`, `GeneticCode`, `GenomicInterval`, `Gene`/`Transcript`/`Genome`, `Protein`, `Variant`, `Dataset`
`Gravicode.Biotech.Net.Workflows`	Snakemake/Nextflow-style workflow engine in C#: wildcards and sample sheets, scatter/gather, parallel DAG scheduling with resources, retries and timeouts, incremental re-runs from content hashes, atomic outputs, shell and C# steps, run reports, DOT/Mermaid export
`Gravicode.Biotech.Net.Sequences`	FASTA/FASTQ/GenBank/EMBL/PDB I/O, ORFs, motifs, restriction, k-mers, Tm, codon usage
`Gravicode.Biotech.Net.Alignments`	substitution matrices, pairwise and multiple alignment, phylogenetics, database search
`Gravicode.Biotech.Net.Genomics`	VCF, variant effects, read mapping, SNV calling, assembly, gene finding, population genetics
`Gravicode.Biotech.Net.Transcriptomics`	normalisation, DESeq2-style and limma-voom-style DE, ORA/GSEA, single cell
`Gravicode.Biotech.Net.Proteomics`	ProtParam, digestion, MS/MS search with target–decoy FDR, quantification, classification
`Gravicode.Biotech.Net.StructuralBiology`	PDB/mmCIF, geometry, DSSP, SASA, superposition, pockets, interactions
`Gravicode.Biotech.Net.Chemistry`	SMILES/SDF, descriptors, fingerprints, substructure search, scaffolds
`Gravicode.Biotech.Net.DrugDiscovery`	virtual screening, target prediction, ADMET, lead optimisation, QSAR
`Gravicode.Biotech.Net.SyntheticBiology`	codon optimisation, primers, Gibson/Golden Gate, circuits, CRISPR analysis
`Gravicode.Biotech.Net.Data`	NCBI E-utilities, UniProt, RCSB PDB, AlphaFold DB and Ensembl REST clients with rate limiting, retries and an offline-capable cache
`Gravicode.Biotech.Net.Gpu`	ILGPU kernels (CUDA, OpenCL, CPU accelerator): all-vs-all Smith–Waterman scores bit-identical to the CPU path, batched Vina pose scoring and Monte-Carlo docking; falls back to the CPU without a GPU
`Gravicode.Biotech.Net.AI`	HF.Net model zoo, embeddings, ESM variant scoring, LLM copilot
`Gravicode.Biotech.Net.Visualization`	genome browser, heatmap, volcano, PCA/UMAP, protein and molecule viewers
`Gravicode.Biotech.Net.Notebooks`	rich formatters for .NET Interactive / Polyglot Notebooks

Documentation

English: docs/en — getting started, installation, tutorials, API reference, samples, benchmarks, roadmap
Bahasa Indonesia: docs/id

Every C# snippet in the documentation is compiled and executed against the real API before publication, and every figure is rendered by Biotech.Net.Visualization itself.

Performance

Measured on an Intel Core i7-8650U (BenchmarkDotNet, short job). Ratio is Rust time ÷ managed time, so lower is faster:

Kernel	Managed	Rust	Ratio
Local score batch (300 aa × 500 targets)	295,240 µs	6,270 µs	0.02
Reverse complement (1 Mb)	625.8 µs	80.7 µs	0.13
Kabsch RMSD (10,000 atoms)	246.5 µs	96.1 µs	0.39
k-mer counting, k = 8 (1 Mb)	4,698 µs	2,014 µs	0.44

Full results, including the cases where the managed path currently wins: docs/en/benchmarks.md.

Bahasa Indonesia

Biotech.Net adalah platform open-source untuk bioteknologi, bioinformatika, biologi komputasi, genomika, proteomika, penemuan obat, biologi sintetik, dan AI bioteknologi, dibangun untuk .NET 10. Jalur kritis berjalan di kernel Rust lewat C ABI; setiap kernel juga punya implementasi C# managed, jadi pustaka ini tetap bekerja tanpa biner native.

Mulai cepat

dotnet add package Gravicode.Biotech.Net.Core
dotnet add package Gravicode.Biotech.Net.Sequences

using Biotech.Net.Core;
using Biotech.Net.Sequences;

var dna = Sequence.Dna("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG", "demo");
Console.WriteLine($"{dna.Length} bp, GC {dna.GcContent():P1}");
Console.WriteLine(dna.ReverseComplement());
Console.WriteLine(dna.Translate(toStop: true));              // MAIVMGR
Console.WriteLine($"{OrfFinder.Find(dna, new OrfOptions { MinLength = 30 }).Count} ORF");

Modul

Daftar paket sama seperti tabel di bagian Inggris di atas: Native, Core, Sequences, Alignments, Genomics, Transcriptomics, Proteomics, StructuralBiology, Chemistry, DrugDiscovery, SyntheticBiology, Data, Gpu, AI, Visualization, dan Notebooks — semuanya diawali Gravicode.Biotech.Net..

Dokumentasi

Bahasa Indonesia: docs/id — pendahuluan, instalasi, tutorial, referensi API, contoh, benchmark, roadmap
English: docs/en

Setiap cuplikan C# di dokumentasi dikompilasi dan dijalankan terhadap API yang sebenarnya sebelum diterbitkan, dan setiap gambar dirender oleh Biotech.Net.Visualization sendiri.

Screenshots — Biotech.Net Gallery

The Avalonia showcase (samples/Biotech.Net.Gallery): six modules, each running real library code with a live code tab and PNG/SVG export.

Example figures produced by Biotech.Net.Visualization:

Web Gallery and C# Playground — in the browser

Try it live: https://dotnetvibecoderz.github.io/Vibe_Bio/

samples/Biotech.Net.WebGallery is a Blazor WebAssembly twin of the desktop Gallery: DNA Explorer, Genome Browser, Protein Explorer (with 3Dmol.js), Drug Discovery Lab, CRISPR Designer, Transcriptomics (DESeq + volcano) and an in-browser C# Playground. In the Playground, Roslyn compiles snippets against the loaded Biotech.Net assemblies and Show(...) renders figures. Everything runs client-side on the managed kernels. Run it with dotnet run --project samples/Biotech.Net.WebGallery, and see docs/en/web-gallery.md for browser limits and GitHub Pages deployment.

Bahasa Indonesia: versi peramban dari Gallery, lengkap dengan C# Playground. Semuanya berjalan di sisi klien. Lihat docs/id/web-gallery.md.

Building from source

dotnet build Biotech.Net.slnx                  # builds the Rust crate too when cargo is on PATH
dotnet build -p:SkipRustBuild=true             # reuse an existing native binary
dotnet test Biotech.Net.slnx
cd native/biotech-native && cargo test --release

Requires the .NET 10 SDK. The Rust toolchain is optional — without it every kernel falls back to managed C#.

Credits & license

Dibuat oleh Gravicode Studios dipimpin oleh Kang Fadhil · Created by Gravicode Studios, led by Kang Fadhil.

Product	Compatible and additional computed target framework versions.
.NET	net10.0 is compatible. net10.0-android was computed. net10.0-browser was computed. net10.0-ios was computed. net10.0-maccatalyst was computed. net10.0-macos was computed. net10.0-tvos was computed. net10.0-windows was computed.

Compatible target framework(s)

Included target framework(s) (in package)

Learn more about Target Frameworks and .NET Standard.

net10.0
- Gravicode.Biotech.Net.Chemistry (>= 0.2.0)
- Gravicode.Biotech.Net.Core (>= 0.2.0)
- Gravicode.Biotech.Net.StructuralBiology (>= 0.2.0)

NuGet packages (1)

Showing the top 1 NuGet packages that depend on Gravicode.Biotech.Net.DrugDiscovery:

Package	Downloads
Gravicode.Biotech.Net.Gpu GPU kernels on ILGPU (CUDA, OpenCL, CPU accelerator): all-vs-all Smith-Waterman scoring and batched Vina-style docking, with automatic fallback to the Rust/managed CPU path. Dibuat oleh Gravicode Studios, dipimpin oleh Kang Fadhil.	0

GitHub repositories

This package is not used by any popular GitHub repositories.

Version	Downloads	Last Updated
0.2.0	0	10/20/2026
0.1.0	80	10/15/2026