Core.Cast-Transform-Convert 3.2.0.94

dotnet add package Core.Cast-Transform-Convert --version 3.2.0.94

NuGet\Install-Package Core.Cast-Transform-Convert -Version 3.2.0.94

This command is intended to be used within the Package Manager Console in Visual Studio, as it uses the NuGet module's version of Install-Package.

<PackageReference Include="Core.Cast-Transform-Convert" Version="3.2.0.94" />

For projects that support PackageReference, copy this XML node into the project file to reference the package.

paket add Core.Cast-Transform-Convert --version 3.2.0.94

The NuGet Team does not provide support for this client. Please contact its maintainers for support.

#r "nuget: Core.Cast-Transform-Convert, 3.2.0.94"

#r directive can be used in F# Interactive and Polyglot Notebooks. Copy this into the interactive tool or source code of the script to reference the package.

// Install Core.Cast-Transform-Convert as a Cake Addin
#addin nuget:?package=Core.Cast-Transform-Convert&version=3.2.0.94

// Install Core.Cast-Transform-Convert as a Cake Tool
#tool nuget:?package=Core.Cast-Transform-Convert&version=3.2.0.94

The NuGet Team does not provide support for this client. Please contact its maintainers for support.

An easy-to-use, portable, tested, documented, serializable, thread-safe, strongly typed library for changing between unrestricted, arbitrary data types

There are no supported framework assets in this package.

Learn more about Target Frameworks and .NET Standard.

- CSharp.Portable-Singleton (>= 2.0.0.4)

NuGet packages

This package is not used by any NuGet packages.

GitHub repositories

This package is not used by any popular GitHub repositories.

Version	Downloads	Last updated
3.2.0.94	2,213	11/1/2016
3.2.0.93	1,702	11/1/2016
3.2.0.92	1,714	11/1/2016
3.2.0.91	1,758	11/1/2016
3.2.0.89	1,433	10/19/2016
3.2.0.86	1,480	10/17/2016
3.2.0.84	1,511	10/17/2016
3.2.0.82	1,504	10/17/2016
3.2.0.81	1,472	10/14/2016
3.2.0.80	1,462	10/14/2016
3.2.0.79	1,475	10/14/2016
3.2.0.78	1,520	10/13/2016
3.2.0.77	1,452	10/13/2016
3.2.0	1,441	10/13/2016
3.1.0.69	1,442	10/9/2016
3.1.0.5	1,593	10/9/2016
3.1.0.2	2,263	9/21/2016
3.1.0	1,473	10/3/2016
3.0.1.4	1,538	9/13/2016
3.0.1	1,458	10/3/2016

=== Key Features ===

-Central thread-safe pool of converting functions
-Data Encapsulation
-Add converters at runtime or compile-time
-Consistent exception behavior
-Optional functions following the "Try" convention of .NET
-Instant improvement of source-code readability and maintainability
-Low overall performance impact
-Little to no learning curve
-Independent, portable library

______________________________________________________

### Changelog with the most recent changes

* 61 seconds ago (HEAD -> master, origin/master, origin/HEAD) Travis: added additional null checks due to Mono reflection shortcoming (Lorenz Lo Sauer)
* 18 minutes ago Tests: Segmented ConverterCollection into smaller units; Travis: remove dispose-runner option; (Lorenz Lo Sauer)
* 72 minutes ago Travis: fix for missing instance due to test-instance disposal (Lorenz Lo Sauer)
* 3 hours ago Tests: Added missing dipose-call (Lorenz Lo Sauer)
* 3 hours ago Tests: added comprehensive test evalutation using the 'dynamc ' collection setting (Lorenz Lo Sauer)
* 3 hours ago Tests: added test scenariors to check the functionality of the deferred AddBuilder class (Lorenz Lo Sauer)
* 3 hours ago Tests: Added crucial test for probing the intregrity of the ConverterCollection (Lorenz Lo Sauer)
*    3 hours ago Merge branch 'master' of https://github.com/lsauer/dotnet-portable-cast-convert-transform (Lorenz Lo Sauer)
|\
| * 5 days ago Readme: added stackoverflow flair-theme [ci skip] (Lorenz Lo Sauer)
* | 3 hours ago Tests: Moved two tests from ConvertTo and added separate, advanced tests for CastTo; (Lorenz Lo Sauer)
|/
*    13 days ago Merge branch 'master' of https://github.com/lsauer/dotnet-portable-cast-convert-transform (Lorenz Lo Sauer)
|\
| * 13 days ago appveyor: added powershell scripts to the set of monitored build-files (Lorenz Lo Sauer)
* | 13 days ago appveyor: added powershell scripts to the set of monitored build-files (Lorenz Lo Sauer)
|/
* 13 days ago Nuget packaging: fixed missing dynamic build-path in the nuspec file (Lorenz Lo Sauer)
* 13 days ago Tests: Added new tests to the csproj; Added a direct csproj reference to the TypeCast library (Lorenz Lo Sauer)
* 13 days ago Tests: Added tests for custom NumberFormatInfo based conversions [ci skip] (Lorenz Lo Sauer)
* 13 days ago Improved: Added a new ConverterCollectionCause to the exception enumeration list; Better handling of a missing assembly exception during initialization (Lorenz Lo Sauer)
* 13 days ago Improved: Renamed variable to better reflect its purpose [ci skip] (Lorenz Lo Sauer)
* 13 days ago   Improved: Allow Disambiguates when the ConverterMethodAttribute has a Name property set (Lorenz Lo Sauer)
* 13 days ago Improved: Better creation of Standard Converters, designated with object as Argument-Type [ci skip] (Lorenz Lo Sauer)
* 13 days ago Tests: Added a CaptureDataException for throwing data-objects at a desired point outside a method for analysis [ci skip] (Lorenz Lo Sauer)
* 13 days ago Improved: Cleaned up unecessary code-lines (Lorenz Lo Sauer)

______________________________________________________

### Getting started in 4 steps

1. *Install* with the <a href="http://goo.gl/iekUWH" target="_blank">NuGet Package manager</a>: `PM> Install-Package Core.TypeCast`.
2. *Add the namespace* to your top-listed using directives: `using Core.TypeCast;`.
3. *Create a class* with one or more methods: `class MyConverter { ... int MyConverter(string argument) ... }`
4. *Attribute* any class with `[ConverterAttribute]`: _`public class MyConverter { ... }`_.
   Subsequently, attribute the converting methods using `[ConverterMethodAttribute]`: _`public int MyConverter(string attribute){ ... }`__
5. **Done!**

Now, invoke conversions in your code anywhere as follows:
```cs
   var castedInt = "500s".CastTo<int>();
   var protein = "GAGTGCGCCCTCCCCGCACATGCGCCCTGACAGCCCAACAATGGCGGCGCCCGCGGAGTC".ConvertTo<IProtein>();
```
Use library functions which suit the change of type descriptively:

   `var complimentary = "GAGTGCGCCCTCCCCGCACATGCGCCCTGACAGCCCAACAATGGCGGCGCCCGCGGAGTC".Transform<Complementary>();`

_____________________________________________________

### Code Glance

Provided below is an abbreviated example of what code may look like in your project:

```cs
   using System.Runtime.CompilerServices;
   // IPolyNucleotide.cs
   public interface IPolyNucleotide { ... }

   // used for "Tranform-Aliasing"
   delegate DNA Complimentary(string dnaSequence, AModelClass arguments);

   // DNA.cs
   [Converter]
   public class DNA : IPolyNucleotide
   {
       [ConverterMethod]
       protected IProtein ToProtein(string dnaSequence, bool homologyLookup = false)
       {
           ... ...
       }

       [ConverterMethod]
       [MethodImpl(MethodImplOptions.AggressiveInlining)]
       public static DNA Complimentary(string dnaSequence, AModelClass arguments)
       {
           ... ...
       }
       ...
   }
```